admin 管理员组

文章数量: 1184232


2024年1月17日发(作者:文件上传进度条)

Plasmid Cart

Your cart is empty.

Search for Plasmids:

Recently Viewed

pLKO.1 -

Plasmid 10878

Home

Deposit Plasmids

Request Plasmids

Information

Browse

Search

Pricing

FAQ

Protocols > pLKO.1 Protocol

pLVTHM

Plasmid Tools

APlasmid 12247

Mammalian

Collection

pLKO.1 - TRC Cloning Vector

Addgene Plasmid 10878. Protocol Version 1.0. December 2006.

Copyright Addgene 2006, All Rights Reserved. This protocol is provided for your

convenience. See warranty information in appendix.

Click here for a printable copy.

Table of Contents

A. pLKO.1-TRC Cloning Vector

o

A.1 The RNAi Consortium

o

A.2 Map of pLKO.1

o

A.3 Related plasmids

B. Designing shRNA Oligos for pLKO.1

o

B.1 Determine the optimal 21-mer targets in your gene

o

B.2 Order oligos compatible with pLKO.1

C. Cloning shRNA oligos into pLKO.1

o

C.1 Recommended materials

o

C.2 Annealing oligos

o

C.3 Digesting pLKO.1 TRC-Cloning Vector

o

C.4 Ligating and transforming into bacteria

D. Screening for Inserts

o

D.1 Recommended materials

o

D.2 Screening for inserts

E. Producing Lentiviral Particles

o

E.1 Recommended materials

o

E.2 Protocol for producing lentiviral particles

F. Infecting Target Cells

o

F.1 Recommended materials

o

F.2 Determining the optimal puromycin concentration

o

F.3 Protocol for lentiviral infection and selection

G. Safety

H. References

o

H.1 Published articles

o

H.2 Web resources

I. Appendix

o

I.1 Sequence of pLKO.1 TRC-Cloning Vector

o

I.2 Recipes

o

I.3 Warranty information

Back to Top

A. pLKO.1-TRC Cloning Vector

A.1 The RNAi Consortium

The pLKO.1 cloning vector is the backbone upon which The RNAi

Consortium (TRC) has built a library of shRNAs directed against 15,000

human and 15,000 mouse genes. Addgene is working with the TRC to

make this shRNA cloning vector available to the scientific community.

Please cite Moffat et al., Cell 2006 Mar; 124(6):1283-98 (PubMed) in all

publications arising from the use of this vector.

A.2 Map of pLKO.1

pLKO.1 is a replication-incompetent lentiviral vector chosen by the TRC

for expression of shRNAs. pLKO.1 can be introduced into cells via direct

transfection, or can be converted into lentiviral particles for subsequent

infection of a target cell line. Once introduced, the puromycin resistance

marker encoded in pLKO.1 allows for convenient stable selection.

Figure 1 : Map of pLKO.1 containing an shRNA insert. The original

pLKO.1-TRC cloning vector has a 1.9kb stuffer that is released by

digestion with AgeI and EcoRI. shRNA oligos are cloned into the AgeI

and EcoRI sites in place of the stuffer. The AgeI site is destroyed in

most cases (depending on the target sequence), while the EcoRI site is

preserved. For a complete map of pLKO.1 containing the 1.9kb stuffer,

visit /10878.

Description Vector Element

U6

cPPT

Human U6 promoter drives RNA Polymerase III

transcription for generation of shRNA transcripts.

Central polypurine tract, cPPT, improves transduction

efficiency by facilitating nuclear import of the vector's

preintegration complex in the transduced cells.

Human phosphoglycerate kinase promoter drives

expression of puromycin.

Puromycin resistance gene for selection of pLKO.1

plasmid in mammalian cells.

3' Self-inactivating long terminal repeat.

hPGK

Puro R

sin 3'LTR

f1 ori

Amp R

pUC ori

5'LTR

RRE

f1 bacterial origin of replication.

Ampicillin resistance gene for selection of pLKO.1 plasmid

in bacterial cells

pUC bacterial origin of replication.

5' long terminal repeat.

Rev response element.

Figure 2 : Detail of shRNA insert. The U6 promoter directs RNA

Polymerase III transcription of the shRNA. The shRNA contains 21

"sense" bases that are identical to the target gene, a loop

containing an XhoI restriction site, and 21 "antisense" bases that

are complementary to the "sense" bases. The shRNA is followed

by a polyT termination sequence for RNA Polymerase III.

A.3 Related Products

The following plasmids available from Addgene are recommended for use

in conjunction with the pLKO.1 TRC-cloning vector.

Plasmid (Addgene ID #)

pLKO.1 - TRC control

(10879)

Description

Negative control vector containing

non-hairpin insert.

pLKO.1 - scramble shRNA Negative control vector containing

(1864) scrambled shRNA.

psPAX2 (12260) Packaging plasmid for producing viral

particles.

pMD2.G (12259) Envelope plasmid for producing viral

particles.

Note: pLKO.1 can also be used with packaging plasmid pCMV-dR8.2

dvpr (Addgene #8455) and envelope plasmid pCMV-VSVG (Addgene

#8454) from Robert Weinberg's lab. For more information, visit Addgene's

Mammalian RNAi Tools page.

Several other laboratories have deposited pLKO derived vectors that may

also be useful for your experiment. To see these vectors, visit Addgene's

website and search for "pLKO".

Back to Top

B. Designing shRNA Oligos for pLKO.1

B.1 Determining the Optimal 21-mer Targets in your Gene

Selection of suitable 21-mer targets in your gene is the first step toward

efficient gene silencing. Methods for target selection are continuously

being improved. Below are suggestions for target selection.

1. Use an siRNA selection tool to determine a set of top-scoring targets

for your gene. For example, the Whitehead Institute for Biomedical

Research hosts an siRNA Selection Program that can be accessed after

a free registration (/bioc/siRNAext/). If you have

MacOS X, another excellent program is iRNAi, which is provided free by

the company Mekentosj (/irnai/).

A summary of guidelines for designing siRNAs with effective gene

silencing is included here:

Starting at 25nt downstream of the start codon (ATG), search for

21nt sequences that match the pattern AA(N19). If no suitable

match is found, search for NAR(N17)YNN, where N is any

nucleotide, R is a purine (A,G), and Y is a pyrimidine (C,U).

G-C content should be 36-52%.

Sense 3' end should have low stability – at least one A or T

between position 15-19.

Avoid targeting introns.

Avoid stretches of 4 or more nucleotide repeats, especially

repeated Ts because polyT is a termination signal for RNA

polymerase III.

2. To minimize degradation of off-target mRNAs, use NCBI's BLAST

program. Select sequences that have at least 3 nucleotide mismatches to

all unrelated genes.

Addgene recommends that you select multiple target

sequences for each gene. Some sequences will be more effective

than others. In addition, demonstrating that two different shRNAs

that target the same gene can produce the same phenotype will

alleviate concerns about off-target effects.

B.2 Ordering Oligos Compatible with pLKO.1

To generate oligos for cloning into pLKO.1, insert your sense and

antisense sequences from step B.1 into the oligos below. Do not change

the ends; these bases are important for cloning the oligos into the pLKO.1

TRC-cloning vector.

Forward oligo:

5' CCGG—21bp sense—CTCGAG—21bp antisense—TTTTTG 3'

Reverse oligo:

5' AATTCAAAAA—21bp sense—CTCGAG—21bp antisense 3'

For example, if the target sequence is (AA)TGCCTACGTTAAGCTATAC,

the oligos would be:

Forward oligo:

5'

CCGGAATGCCTACGTTAAGCTATACCTCGAGGTATAGCTTAACGTAGGCATTTTTTTG 3'

Reverse oligo:

5'

AATTCAAAAAAATGCCTACGTTAAGCTATACCTCGAGGTATAGCTTAACGTAGGCATT 3'

Back to Top

C. Cloning Oligos into pLKO.1

The pLKO.1-TRC cloning vector contains a 1.9kb stuffer that is released

upon digestion with EcoRI and AgeI.

The oligos from section B contain the shRNA sequence flanked by

sequences that are compatible with the sticky ends of EcoRI and AgeI.

Forward and reverse oligos are annealed and ligated into the pLKO.1

vector, producing a final plasmid that expresses the shRNA of interest.

C.1 Recommended Materials

Material

AgeI

EcoRI

T4 DNA ligase

NEB buffer 2

Vendor and catalog #

New England Biolabs (NEB) #R0552S

NEB #R0101S

NEB #M0202S

NEB #B7002S

DH5 alpha competent cells Invitrogen #18258-012

Qiaquick gel extraction kit Qiagen #28704

Low melting point agarose Sigma #A9414

Luria Broth Agar (LB agar) American Bioanalytical: #AB01200-02000

Ampicillin

Carbenicillin

C.2 Annealing Oligos

1. Resuspend oligos in ddH2O to a concentration of 20 μM, then mix:

5 μL Forward oligo

5 μL Reverse oligo

5 μL 10x NEB buffer 2

35 μL ddH2O

2. Incubate for 4 minutes at 95oC in a PCR machine or in a beaker of

boiling water.

3. If using a PCR machine, incubate the sample at 70oC for 10 minutes

then slowly cool to room temperature over the period of several hours. If

using a beaker of water, remove the beaker from the flame, and allow the

water to cool to room temperature. This will take a few hours, but it is

important for the cooling to occur slowly for the oligos to anneal.

C.3 Digesting pLKO.1 TRC Cloning Vector

VWR: #7177-48-2. Use at 100 μg/mL.

VWR: #80030-956. Use at 100 μg/mL.

1. Digest pLKO.1 TRC-cloning vector with AgeI. Mix:

6 μg

5 μL

1 μL

pLKO.1 TRC-cloning vector (maxiprep or miniprep DNA)

10x NEB buffer 1

AgeI

to 50 μL ddH2O

> Incubate at 37oC for 2 hours.

2. Purify with Qiaquick gel extraction kit. Elute in 30 μL of ddH2O.

3. Digest eluate with EcoRI. Mix:

30 μL pLKO.1 TRC-cloning vector digested with AgeI

5 μL 10x NEB buffer for EcoRI

1 μL EcoRI

14 μL ddH2O

> Incubate at 37oC for 2 hours.

4. Run digested DNA on 0.8% low melting point agarose gel until you can

distinctly see 2 bands, one 7kb and one 1.9kb. Cut out the 7kb band and

place in a sterile microcentrifuge tube.

When visualizing DNA fragments to be used for ligation, use

only long-wavelength UV light. Short wavelength UV light will

increase the chance of damaging the DNA.

5. Purify the DNA using a Qiaquick gel extraction kit. Elute in 30 μL of

ddH2O.

6. Measure the DNA concentration.

C.4 Ligating and Transforming into Bacteria

1. Use your ligation method of choice. For a standard T4 ligation, mix:

2 μL

20 ng

2 μL

1 μL

annealed oligo from step C.2.

digested pLKO.1 TRC-cloning vector from step C.3. (If

you were unable to measure the DNA concentration,

use 1 μL)

10x NEB T4 DNA ligase buffer

NEB T4 DNA ligase

to 20 μL ddH2O

> Incubate at 16oC for 4-20 hours.

2. Transform 2 μL of ligation mix into 25 μL competent DH5 alpha cells,

following manufacturer's protocol. Plate on LB agar plates containing 100

μg/mL ampicillin or carbenicillin (an ampicillin analog).

Back to Top

D. Screening for Inserts

You may screen for plasmids that were successfully ligated by restriction

enzyme digestion. However, once you have identified the positive clones,

it is important to verify the insert by conducting a sequencing reaction.

D.1 Recommended Materials

Material Vendor and catalog #

DNA Miniprep Kit Qiagen #27104

EcoRI

NcoI

Agarose

NEB #R0101S

NEB #R0193S

Sigma #A9539

D.2 Screening for Inserts

Day 1:

1. Innoculate 5 colonies from each ligation into LB + 100 μg/mL

ampicillin or carbenicillin.

Day 2:

2. Spin down the cultures and use a miniprep kit to obtain DNA.

3. Conduct a restriction digest with EcoRI and NcoI:

1 μg

2 μL

miniprep DNA

10x NEB buffer for EcoRI

0.8 μL EcoRI

0.8 μL NcoI

to 20 μL ddH2O

> Incubate at 37oC for 1-2 hours.

4. Run the digestion products on a 1% agarose gel. You should

see two fragments, a 2kb fragment and a 5kb fragment.

5. Sequence positive clones with pLKO.1 sequencing primer (5'

CAA GGC TGT TAG AGA GAT AAT TGG A 3').

You may need to adjust the sequencing conditions if the

DNA polymerase has difficulty reading through the

secondary structure of the hairpin sequence.

Back to Top

E. Producing Lentiviral Particles

Before this step, you must contact your institution's Bio-Safety office to

receive permission and institution-specific instructions. You must follow

safety procedures and work in an environment (e.g. BL2+) suitable for

handling HIV-derivative viruses.

For transient knockdown of protein expression, you may transfect plasmid

DNA directly into the target cells. The shRNA will be expressed, but the

DNA is unlikely to be integrated into the host genome.

For stable loss-of-function experiments, Addgene recommends that you

generate lentiviral particles and infect the target cells. Addition of

puromycin will allow you to select for cells that stably express your shRNA

of interest.

E.1 Recommended Materials

Material

psPAX2

pMD2.G

HEK-293T cells

Vendor and catalog #

Addgene #12260

Addgene #12259

GenHunter: #Q401

FuGENE® 6 Transfection Reagent Roche Applied Biosciences:

#

OPTI-MEM® serum-free media Invitrogen: #31985

Dulbecco's Modified Eagle Medium Invitrogen: #11995

(DMEM)

Fetal Bovine Serum (FBS)

Penicillin/Streptomycin

Polypropylene tubes

Invitrogen: #16000

Invitrogen: #15140-122

VWR: #87003-290

Note: pLKO.1 could also be packaged using pCMV-dR8.2 dvpr and

pCMV-VSVG from the Robert Weinberg lab. For more information, visit

Addgene's Mammalian RNAi Tools page.

E.2 Protocol for Producing Lentiviral Particles

This protocol is for transfection in a 6 cm plate. The protocol can be

scaled to produce different amounts of virus as needed.

Day 1:

a. For each plasmid to be transfected, plate 7x105 HEK-293T cells

in 5 mL of media in a 6 cm tissue culture plate. Incubate cells at

37oC, 5% CO2 overnight.

Although cells should regularly be passaged in DMEM +

10% FBS with penicillin/streptomycin, cells should be

plated at this step in DMEM + 10% FBS without antibiotics

(no penicillin or streptomycin).

Day 2:

b. Perform the transfection in the late afternoon because the

transfection mix should only be incubated with the cells for 12-15

hours.

c. In polypropylene microfuge tubes (do NOT use polystyrene

tubes), make a cocktail for each transfection:

1 μg pLKO.1 shRNA plasmid

750 ng psPAX2 packaging plasmid

250 ng pMD2.G envelope plasmid

to 20 μl serum-free OPTI-MEM

You may want to vary the ratio of shRNA plasmid,

packaging plasmid, and envelope plasmid to obtain the

ratio that gives you the optimal viral production.

d. Create a master mix of FuGENE® 6 transfection reagent in

serum-free OPTI-MEM. Calculate the amount of Fugene® and

OPTI-MEM necessary given that each reaction will require 6 μL

FuGENE® + 74 μL OPTI-MEM. For example:

1x master mix: 6 μL FuGENE® + 74 μL OPTI-MEM

5x master mix: 30 μL FuGENE® + 370 μL OPTI-MEM

10x master mix: 60 μL FuGENE® + 740 μL OPTI-MEM

In a polypropylene tube, add OPTI-MEM first. Pipette FuGENE®

directly into the OPTI-MEM - do not allow FuGENE® to come in

contact with the walls of the tube before it has been diluted. Mix by

swirling or gently flicking the tube. Incubate for 5 minutes at room

temperature.

e. Add 80 μL of FuGENE® master mix to each tube from step c for

a total volume of 100 μL. Pipette master mix directly into the liquid

and not onto the walls of the tube. Mix by swirling or gently flicking

the tube.

f. Incubate for 20-30 minutes at room temperature.

g. Retrieve HEK-293T cells from incubator. The cells should be

50-80% confluent and in DMEM that does not contain antibiotics.

h. Without touching the sides of the dish, gently add

DNA:FuGENE® mix dropwise to cells. Swirl to disperse mixture

evenly. Do not pipette or swirl too vigorously, as you do not want

to dislodge the cells from the plate.

i. Incubate cells at 37oC, 5% CO2 for 12-15 hours.

Day 3:

j. In the morning, change the media to remove the transfection

reagent. Replace with 5 mL fresh DMEM + 10% FBS +

penicillin/streptomycin. Pipette the media onto the side of the plate

so as not to disturb the transfected cells.

k. Incubate cells at 37oC, 5% CO2 for 24 hours.

Day 4:

l. Harvest media from cells and transfer to a polypropylene

storage tube. The media contains your lentiviral particles. Store at

4oC.

m. Add 5 mL of fresh media containing antibiotics to the cells and

incubate at 37oC, 5% CO2 for 24 hours.

Day 5:

n. Harvest media from cells and pool with media from Day 4. Spin

media at 1,250 rpm for 5 minutes to pellet any HEK-293T cells

that were inadvertently collected during harvesting.

In lieu of centrifugation, you may filter the media through

a 0.45 μm filter to remove the cells. Do not use a 0.2 μm

filter, as this is likely to shear the envelope of your virus.

o. Virus may be stored at 4oC for a few days, but should be frozen

at -20oC or -80oC for long-term storage.

Freeze/thaw cycles decrease the efficiency of the virus,

so Addgene recommends that you use the virus

immediately or aliquot the media into smaller tubes to

prevent multiple freeze/thaw cycles.

Back to Top

F. Infecting Target Cells

Lentiviral particles can efficiently infect a broad range of cell types,

including both dividing and non-dividing cells. Addition of puromycin will

allow you to select for cells that are stably expressing your shRNA of

interest.

F.1. Recommended Materials

Material Vendor and catalog #

Hexadimethrine bromide (polybrene)* Sigma-Aldrich: #H9268

Protamine Sulfate*

Puromycin*

Target cells

Culture media for target cells

Materials for assay

MP Biomedicals: #194729

Sigma-Aldrich: #P8833

Varies based on your experiment

Varies based on your experiment

Varies based on your experiment

* Detailed protocols for preparing polybrene, protamine sulfate, and

puromycin are located in the Appendix.

F.2. Determining the Optimal Puromycin Concentration

Each cell line responds differently to puromycin selection. Addgene

strongly recommends that you determine the optimal puromycin

concentration for your cell line before initiating your experiment.

Day 1:

a. Plate target cells in ten 6 cm plates and grow at 37o C, 5% CO2

overnight.

Day 2:

b. The target cells should be approximately 80-90% confluent.

c. Dilute puromycin in the preferred culture media for your target

cells. The final concentration of puromycin should be from 1-10

μg/mL in 1 μg/mL increments.

d. Label plates from 1-10 and add appropriate

puromycin-containing media to cells.

Days 3+:

e. Examine cells each day and change to fresh

puromycin-containing media every other day.

f. The minimum concentration of puromycin that results in

complete cell death after 3-5 days is the concentration that should

be used for selection in your experiments. (You may wish to

repeat this titration with finer increments of puromycin to

determine a more precise optimal puromycin concentration.)

F.3. Protocol for Lentiviral Infection and Selection

Day 1:

a. Plate target cells and incubate at 37oC, 5% CO2 overnight.

Day 2:

b. Target cells should be approximately 70% confluent. Change to

fresh culture media containing 8 μg/mL polybrene.

Polybrene increases the efficiency of viral infection.

However, polybrene is toxic to some cell lines. In these cell

lines, substitute protamine sulfate for polybrene.

c. Add lentiviral particle solution from step E. For a 6 cm target

plate, add between 0.05-1 mL virus (add ≥0.5 mL for a high MOI,

and ≤0.1 mL for a low MOI). Scale the amount of virus added

depending on the size of your target plate.

MOI (multiplicity of infection) refers to the number of

infecting viral particles per cell. Addgene recommends that

you test a range of MOIs to determine the optimal MOI for

infection and gene silencing in your target cell line.

d. Incubate cells at 37oC, 5% CO2 overnight.

Day 3:

e. Change to fresh media 24 hours after infection.

If viral toxicity is observed in your cell line, you may

decrease the infection time to between 4 - 20 hours.

Remove the virus-containing media and replace with fresh

media. Do not add puromycin until at least 24 hours after

infection to allow for sufficient expression of the puromycin

resistance gene.

f. To select for infected cells, add puromycin to the media at the

concentration determined in step E.2.

Addgene recommends that you maintain one uninfected

plate of cells in parallel. This plate will serve as a positive

control for the puromycin selection.

Days 4+:

g. Change to fresh puromycin-containing media as needed every

few days.

h. Assay infected cells. The following recommendations are

guidelines for the number of days you should wait until harvesting

your cells. However, you should optimize the time based on your

cell line and assay:

Assay

Protein knockdown (western blot)

Days post-infection

≥ 4 days

mRNA knockdown (quantitative PCR) ≥ 3 days

Phenotypic assay

Back to Top

≥ 4 days

G. Safety

BL2 safety practices should be followed when preparing and handling

lentiviral particles. Personal protective clothing should be worn at all

times. Use plastic pipettes in place of glass pipettes or needles. Liquid

waste should be decontaminated with at least 10% bleach. Laboratory

materials that come in contact with viral particles should be treated as

biohazardous waste and autoclaved. Please follow all safety guidelines

from your institution and from the CDC and NIH for work in a BL2 facility.

If you have any questions about what safety practice to follow,

please contact your institution's safety office.

To obtain the MSDS for this product, visit /sitemap and

follow the MSDS link.

Back to Top

H. References

H.1. Published Articles

Khvorova A et. al. 2003. Functional siRNAs and miRNAs exhibit strand

bias. Cell 115:209-216. (PubMed)

Moffat J et. al. 2006. A lentiviral RNAi library for human and mouse genes

applied to an arrayed viral high-content screen. Cell 124:1283-1298.

(PubMed)

Naldini L et. al. 1996. In vivo gene delivery and stable transduction of

nondividing cells by a lentiviral vector. Science 272:263-267. (PubMed)

Schwarz DS et. al. 2003. Asymmetry in the assembly of the RNAi enzyme

complex. Cell 115:199-208. (PubMed)

Stewart SA et. al. 2003. Lentivirus-delivered stable gene silencing by

RNAi in primary cells. RNA 9(4):493-501. (PubMed)

Zufferey R et. al. 1997. Multiply attenuated lentiviral vector achieves

efficient gene delivery in vivo. Nat Biotechnol 15(9):871-5. (PubMed)

Zufferey R et. al. 1998. Self-inactivating lentivirus vector for safe and

efficient in vivo gene delivery. J Virol 72(12):9873-80. (PubMed)

H.2. Web resources

Addgene's mammalian RNAi website: /rnaitools

The RNAi Consortium (TRC):

/genome_bio/trc/

Background on RNAi mechanism:

/focus/rnai/animations/animation/

Whitehead siRNA Selection Program: /bioc/siRNAext/

Mekentosj iRNAi Program: /irnai/

Back to Top

I. Appendix

I.1. Sequence of pLKO.1 TRC-Cloning Vector

Click here (/10878) to see the sequence of

pLKO.1 TRC-cloning vector. The vector is 8901 base pairs total, and the

stuffer insert is shown in all capital letters.

I.2. Recipes

Luria Broth Agar (LB agar) + antibiotic

Per 40 grams of powder from American Bioanalytical catalog #

AB01200-02000, LB contains:

10g tryptone

5g yeast extract

10g sodium chloride

15g agar

> Prepare LB agar solution by dissolving 40g of LB powder in 1L

of distilled water. Autoclave and cool to 55oC. Add 1mL of

100mg/mL ampicillin or carbenicillin to obtain a final concentration

of 100 μg/mL antibiotic. Pour plates and store at 4oC.

Hexadimethrine Bromide (Polybrene)

Prepare a 1mg/mL solution of polybrene (Sigma-Aldrich catalog #H9268)

in 0.9% NaCl. Autoclave to sterilize. Stock solution is stable at 4oC for up

to one year. The powder form of polybrene is stable at 4oC for several

years.

Protamine Sulfate

Store protamine sulfate (MP Biomedicals catalog #194729) at 4oC. Freely

soluble in hot water and slightly soluble in cold water.

Puromycin

Prepare a 50mg/mL stock solution of puromycin (Sigma-Aldrich catalog

#P8833) in distilled water. Sterilize by passing through a 0.22 μm filter.

Store aliquots at -20oC.

I.3. Warranty Information

Addgene is committed to providing scientists with high-quality goods and

services. Addgene makes every effort to ensure the accuracy of its

literature, but realizes that typographical or other errors may occur.

Addgene makes no warranty of any kind regarding the contents of any

literature. Literature are provided to you as a guide and on an "AS IS" "AS

AVAILABLE" basis without warranty of any kind either expressed or

implied, including but not limited to the implied warranties of fitness for a

particular purpose, non-infringement, typicality, safety and accuracy.

The distribution of any literature by Addgene is not meant to carry with it,

and does not grant any license or rights of access or use to the materials

described in the literature.

The distribution of materials by Addgene is not meant to carry with it, and

does not grant any license, express or implied, under any patent. All

transfers of materials from Addgene to any party are governed by

Addgene's Terms of Use, Addgene's Terms of Purchase, and applicable

Material Transfer Agreements between the party that deposited the

material at Addgene and the party receiving the material.

Back to Top

Home | Contact | Terms of Use | Privacy Policy | Site Map


本文标签: 进度条 文件 作者 上传